|
|
fasta
# The Computer Language Benchmarks Game
# http://shootout.alioth.debian.org/ # # by Limin Fu global alu = 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA'; typedef tuple<string,list<float> > FreqTable; global iub = ( 'acgtBDHKMNRSVWY', { 0.27, 0.12, 0.12, 0.27 } + { 0.02 : 0.0 : 11 } ); global homosapiens = ( 'acgt', { 0.3029549426680, 0.1979883004921, 0.1975473066391, 0.3015094502008 } ); routine genRandom( lim : float ) { ia = 3877; ic = 29573; im = 139968; imf = 139968.0; seed = 42; while( 1 ){ seed = (seed * ia + ic) % im; yield (lim * seed / imf); } return 0.0; } global gen_random = @genRandom(1.0); routine makeCumulative( table : list<float> ) { for( i = 1 : table.size() -1 ) table[i] += table[i-1]; } routine selectRandom ( table : FreqTable ) { r = gen_random (1); ( syms, freqs ) = table; if (r < freqs[0]) return syms[0]; lo = 0; hi = freqs.size()-1; while (hi > lo+1) { i = (hi + lo) / 2; if (r < freqs[i]) hi = i; else lo = i; } return syms[hi]; } routine randomFasta ( table : FreqTable, n = 0 ) { line = 60; pick = (string) { 0 : line }; makeCumulative( table[1] ); for ( i = 0 : line : n-1 ) { m = ( i + line < n ) ? line : n - i; for (j = 0 : m-1 ) pick[j] = selectRandom ( table ); if( m < line ) pick = pick[ : m-1 ]; stdio.println (pick); } } routine repeatFasta( src='', n=0 ) { line = 60; r = src.size(); s = src + src; for( j = 0 : line : n-1){ m = ( j + line < n ) ? line : n - j; stdio.println( s[ (j % r) : (j % r) + m-1 ] ); } } routine main( n = 100 ) { stdio.println( '>ONE Homo sapiens alu' ); repeatFasta(alu, n*2 ); stdio.println( '>TWO IUB ambiguity codes' ); randomFasta(iub, n*3); stdio.println( '>THREE Homo sapiens frequency' ); randomFasta(homosapiens, n*5); }
view count 1283 times
created at 2009-03-11, 00:15 GMT modified at 2009-03-11, 00:29 GMT |
fu: ... I forgot to say something about the plan for the whole new year in my previous reply. Well, besides w ... (Jan.19,01:40) fu: ... Happy new dragon year (which will start from this sunday)! Actually, it was a busy month (I wish th ... (Jan.18,22:46) ybabel: What's the plan for the new year ? Hello 'vry budy :- ) happy new year (when is the new year for you Fu ?) I saw you come back and comm ... (Jan.18,18:59) |